0

8  automating the promotion or demotion of a domain controller

The Citizen-Soldier or, Memoirs of a Volunteer potx

The Citizen-Soldier or, Memoirs of a Volunteer potx

Khoa học xã hội

... or the day after, if they not leave, a battle will take place Our men appear eager for the fray, and I pray they may be as successful in the fight as they are anxious for one 29 It is half-past ... generals are too d d slow (hic)." The Major is a man of excellent natural capacity, the son of Hon Thomas Ewing, of Lancaster, and brother-in-law of W T Sherman, now a colonel or brigadier-general ... was also of the party He is fifty or fifty-five years old, a thin, spare man, of very ordinary personal appearance, but of fine scientific and literary attainments For some years he was a professor...
  • 143
  • 535
  • 0
History of Cuba; or, Notes of a Traveller in the Tropics pdf

History of Cuba; or, Notes of a Traveller in the Tropics pdf

Khoa học xã hội

... fine large harbors; those of Havana, Niepe and Nuevitas, are among the best The bay of Matanzas is also capacious; Cardenas and the roadstead of Sagua la Grande have plenty of water for brigs and ... Bayamo, CHAPTER I 22 Camaguey, Jagua, Cueyba, Habana and Haniguanica At the head of each was a governor, or king, of whose laws we have no record, or even tradition An unbroken peace reigned among ... Decadence of Spanish power History of Cuba The rovers of the Gulf Havana fortified The tyrant Velasquez Office of captain-general Loyalty of the Cubans Power of the captain-general Cupidity of the...
  • 109
  • 354
  • 0
The financial reporting framework may not provide specific guidance for inclusion or exclusion of a docx

The financial reporting framework may not provide specific guidance for inclusion or exclusion of a docx

Kế toán - Kiểm toán

... auditing and assurance standards and by facilitating the convergence of international and national standards, thereby enhancing the quality and uniformity of practice throughout the world and strengthening ... in the private sector, or materiality for components may also be assessed at a low level This may occur for a variety of reasons, including the context of the matter, or the nature and characteristics ... Example of Basis for Qualified Opinion and Report on other legal and regulatory requirement for use in the public sector Appendix of ISA 600 contains an example of an auditor’s report containing a...
  • 10
  • 176
  • 0
Báo cáo y học:

Báo cáo y học: "Green tea: a new option for the prevention or control of osteoarthritis" ppt

Báo cáo khoa học

... Administration approved therapy for the treatment of rheumatoid arthritis but not for OA due to its limited and short-term effectiveness Maintaining a balance in levels of IL-1β might be important as a ... radiation-induced inflammation-associated skin diseases including skin cancers [9,10] The physician and the patients want to understand the real targets and mechanism of action of GTPs that lead to the prevention ... treatment approach for OA, and agents such as GTPs could fill the gap In fact, complete deletion of the Il1b gene leads to disease exacerbation in a mouse model of OA, suggesting both a catabolic...
  • 2
  • 338
  • 0
The Design and Implementation of a Log-Structured File System

The Design and Implementation of a Log-Structured File System

Quản trị mạng

... log as the most up to date ‘‘truth’’ about the state of the data on disk The main difference is that database systems not use the log as the final repository for data: a separate data area is ... increasing the amount of data lost during a crash For this paper we will assume that crashes are infrequent and that it is acceptable to lose a few seconds or minutes of work in each crash; for applications ... reserved for this purpose The separate data area of these database systems means that they not need the segment cleaning mechanisms of the Sprite LFS to reclaim log space The space occupied by the...
  • 15
  • 1,434
  • 0
reducing the degree or intensity of, or eliminating, pollution

reducing the degree or intensity of, or eliminating, pollution

Công nghệ - Môi trường

... or fog The dry forms are acidic gases or particulates Acid Mine Drainage: Drainage of water from areas that have been mined for coal or other mineral ores The water has a low pH because of ... Pollutants may include almost any natural or artificial composition of airborne matter capable of being airborne They may be in the form of solid particles, liquid droplets, gases, or in combination thereof ... ng Asbestos Assessment: In the asbestos-in-schools program, the evaluation of the physical condition and potential for damage of all friable asbestos containing materials and thermal insulation...
  • 217
  • 423
  • 0
Optimization of design and operating parameters on the year round performance of a multi-stage evacuated solar desalination system using transient mathematical analysis

Optimization of design and operating parameters on the year round performance of a multi-stage evacuated solar desalination system using transient mathematical analysis

Vật lý

... is refined latent heat of vaporization of water at the condenser surface of last stage (J/kg), h fgNs is latent heat of vaporization of water at the condenser surface of the last stage (J/kg), ... condensation The outlet temperature from the flat plate collectors, latent heat and refined latent heat of vaporization of water from each stage and specific heat capacity of water from each stage are averaged ... taken as outlet temperature of the parallel combination Each flat plate collector has an area of 1.35m2 inclined at an angle equal to latitude of Chennai (13o) facing towards due south for the...
  • 26
  • 568
  • 0
the meaning and structure of a narrative a systemic functional analysis

the meaning and structure of a narrative a systemic functional analysis

Khoa học xã hội

... for the syntactic structure of language, it prefers placing the function of language as central (what language does and how language does it) rather than placing the elements of language and their ... grammar are different from formal models of grammar by their focus on the communicative aspect of language 2.4 Metafunctions Halliday developed a theory of the fundamental functions of language ... of the clause; and the Rheme is the remainder of the message The Theme may be a nominal group, an adverbial group, or a prepositional phrase The Theme may be single or multiple, marked or unmarked...
  • 39
  • 826
  • 2
Tài liệu Báo cáo

Tài liệu Báo cáo " The meaning and structure of a science fiction story: a sysyemic functional analysis " doc

Báo cáo khoa học

... declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative ... Sayer verbal said 27 Senser mental understand 28 Actor material working 29 Actor materialswitched on 30 Actor material work 31 Sayer verbal said 32 Goal material are stuck 33 Actor material take ... relational was III Senser mental see Existent relational were Actor material descended Actor material landed Actor material put on Goal Actor material opened Goal Actor material climbed 10 Actor material...
  • 18
  • 712
  • 4
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Báo cáo khoa học

... CTGAGGTTACAGACAACTGTTC CCTTTGACATCGCAAGTGGATCA TTGAGGTGACAGACAATTGCCT TCTTTGACTTCTCAAACTGATCG GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC RPE65c-His-Fwd ... GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC GATATCTTATGGTTTGTACATCCCATGGAAAG GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC AAGCTTCTAAGGTTTGTAGATGCCGTGGAG TGGGGAGGACTTTTATGCTGT CTTTTGTGTAGGTGGGATTCG CTGAGGTTACAGACAACTGTTC ... iron-dependent Characterization of the kinetic parameters of the enzymatic activity of zebrafish RPE65c To determine the steady-state kinetics of the enzymatic activity of zebrafish RPE65c, the assay conditions...
  • 14
  • 753
  • 0
Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

Báo cáo khoa học

... neutral and alkaline pH; PhyH-DII was less stable under the same conditions (Fig 2D) PhyH was basically stable at 35 °C, and retained 60% of the initial activity at 45 °C for 90 when assayed at ... of PhyH-DI and PhyH-DII and two times greater than that of PhyHDII This large variance cannot be ascribed to the function of PhyH-DI alone The dual -domain phytase was shown to be a dimer according ... another single -domain phytase may improve the catalytic efficiency of the latter Materials and methods Strains, plasmids and chemicals E coli Trans1-T1 (TransGen, Beijing, China) and pGEM-T Easy...
  • 9
  • 801
  • 0
Tài liệu Linking the Gaza Strip with the West Bank: Implications of a Palestinian Corridor Across Israel docx

Tài liệu Linking the Gaza Strip with the West Bank: Implications of a Palestinian Corridor Across Israel docx

Ngân hàng - Tín dụng

... the war was the impact of a major hurricane that affected East Pakistan The apathy of the West Pakistani leadership and their failure to aid East Pakistan only aggravated an already tense situation ... member of the Arab League of States, and a signatory of the Arab Transit Agreement of 1977 In terms of this agreement, ‘Palestine’ has the right of free transit over the territories of other Arab ... fact that the West Bank and Gaza Strip are already in close proximity a demand for contiguity has already been met Presumably therefore, the meaning that advocates of safe passage attach to the...
  • 64
  • 307
  • 0
Tài liệu Báo cáo khoa học: Binding of ligands originates small perturbations on the microscopic thermodynamic properties of a multicentre redox protein pptx

Tài liệu Báo cáo khoa học: Binding of ligands originates small perturbations on the microscopic thermodynamic properties of a multicentre redox protein pptx

Báo cáo khoa học

... optimization The half-height widths of the NMR signals were used as a measure of the uncertainty of each NMR data point and an experimental uncertainty of 2% was assumed for the experimental points of the ... values for the redox–Bohr interactions and the macroscopic pKa values are absolute, and therefore the macroscopic pKa values of the various redox stages show only very small modifications relative ... thermodynamic model to the NMR data (for the case of DvHc3:ZnRb), or to the NMR and UV-visible data sets simultaneously (for the case of DvHc3:Pi) using the Marquardt method for parameter optimization...
  • 10
  • 640
  • 0
Tài liệu The Design and Performance of a Real-time CORBA Event Service doc

Tài liệu The Design and Performance of a Real-time CORBA Event Service doc

Tổ chức sự kiện

... Sensor Proxies If data was not availHigh Level able to be pulled, the calling I/O Facade would need to block I/O Facade I/O Facade I/O Facade Abstraction awaiting a result In order for the I/O Facade ... hardware, such as Forward Looking Infrared Radar, requires a new Sensor Proxy, I/O Facades must be altered to take advantage of the new technology ample has the following participants: Aircraft ... correlation of events For instance, an I/O Facade may depend on data from a subset of all Sensor Proxies Furthermore, it may use data from many Sensor Proxies in a single calculation of aircraft position...
  • 20
  • 737
  • 0
Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf

Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf

Báo cáo khoa học

... state B, active state above pH 6.3 side-chain at residue 210 is dispensable, as shown by the fact that H21 0A and H210S are as active as native API with VLK-MCA as a substrate (Table 1) This means ... by the Trp169–His210 stacking, suggesting that API has a catalytic quadruple apparatus, composed of Ser194, His57, Asp113 and His210, rather than a catalytic triad ACKNOWLEDGEMENT We are grateful ... to Dr T Yamazaki for NMR measurements, Y Yagi for the amino acid analysis, and Y Yoshimura for the sequence analysis REFERENCES Masaki, T., Nakamura, K., Isono, M & Soejima, M (1978) A new proteolytic...
  • 7
  • 603
  • 0
Đề tài

Đề tài " Numerical characterization of the K¨ahler cone of a compact K¨ahler manifold " doc

Thạc sĩ - Cao học

... there exists a very neat characterization of nef classes on arbitrary surfaces, K¨hler or not a The Main Theorem has an important application to the deformation theory of compact K¨hler manifolds, ... Annals of Mathematics, 159 (2004), 1247–1274 Numerical characterization of the K¨hler cone of a compact K¨hler manifold a a By Jean-Pierre Demailly and Mihai Paun Abstract The goal of this work ... MIHAI PAUN The proof is based on a mass concentration technique for Monge-Amp`re e equations, using the Aubin-Calabi-Yau theorem We first start with an easy lemma, which was (more or less) already...
  • 29
  • 468
  • 0
Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt

Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt

Báo cáo khoa học

... whether activated HP8Xa could hydrolyze the HP8 substrate Ile-Glu-Ala-Arg-p-nitroanilide (IEARpNA) [31] ProHP8Xa lacked IEARase activity, but after the zymogen was activated by factor Xa, IEARase ... sexta HP8 Bands representing the proHP8Xa zymogen, a truncated form of proHP8Xa and the catalytic domain of active HP8 are marked with arrowheads The size and position of molecular weight standards ... used as template for quantitative RT-PCR analysis The M sexta ribosomal protein S3 (rpS3) mRNA was used as an internal standard to normalize the amount of RNA template The primer pairs used are...
  • 15
  • 540
  • 0
Understanding the Insider Threat - Proceedings of a March 2004 Workshop potx

Understanding the Insider Threat - Proceedings of a March 2004 Workshop potx

Khoa học xã hội

... dataset of normal, and “insider threat” network activities; data from the ARDA NIMD4 study; data obtained from use of the Glass Box5 software; synthetically generated data from a simulator; and ... Another insider installs a keystroke logger to get a few passwords to another computer in the same office • A database administrator makes an extra copy of the database files, but says the tapes ... (including that of a system administrator), and artificial or real sensor data that include a mix of legitimate and malicious activity Potential sources for the development of such datasets include a MITRE...
  • 137
  • 344
  • 0
Report of the Special Rapporteur on the promotion and protection of the right to freedom of opinion and expression, Frank La Rue* ppt

Report of the Special Rapporteur on the promotion and protection of the right to freedom of opinion and expression, Frank La Rue* ppt

Quản trị mạng

... significant leap forward as an interactive medium Indeed, with the advent of Web 2.0 services, or intermediary platforms that facilitate participatory information sharing and collaboration in the creation ... laws that clearly guarantee the right of all individuals to ascertain in an intelligible form whether, and if so what, personal data is stored in automatic data files, and for what purposes, and ... independent of any political, commercial, or other unwarranted influences in a manner that is neither arbitrary nor discriminatory There should also be adequate safeguards against abuse, including the...
  • 22
  • 400
  • 0
Báo cáo khoa học: Val216 decides the substrate specificity of a-glucosidase in Saccharomyces cerevisiae doc

Báo cáo khoa học: Val216 decides the substrate specificity of a-glucosidase in Saccharomyces cerevisiae doc

Báo cáo khoa học

... II of maltase is the catalytic nucleophile Because the Asp214 of maltase is equivalent to the Asp215 of isomaltase, a mutant with the residue altered to Ala was tested for its activity on a- pNPG ... from ORF YGR287c The sequence data for isomaltase is available from the DNA Data Bank of Japan with accession number AB109221 The entire coding region of the insert was amplified by PCR and subcloned ... characterized based on substrate specificities for maltase, isomaltase, a- mg, sucrose, and a- pNPG, and the Km for a- pNPG MAa/IMb and IMa/MAb were constructed by a recombination of the N-terminal...
  • 7
  • 452
  • 0

Xem thêm